Characterization of the CD200 Receptor Family in Mice and Humans and Their Interactions with ...

Characterization of the CD200 Receptor Family in Mice and Humans and Their Interactions with CD200 This information is current as of October 12, 2017.

Gavin J. Wright, Holly Cherwinski, Mildred Foster-Cuevas, Gary Brooke, Michael J. Puklavec, Mike Bigler, Yaoli Song, Maria Jenmalm, Dan Gorman, Terri McClanahan, Man-Ru Liu, Marion H. Brown, Jonathon D. Sedgwick, Joseph H. Phillips and A. Neil Barclay

References Subscription Permissions Email Alerts

This article cites 39 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/171/6/3034.full#ref-list-1 Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

J Immunol 2003; 171:3034-3046; ; doi: 10.4049/jimmunol.171.6.3034 http://www.jimmunol.org/content/171/6/3034

The Journal of Immunology

Characterization of the CD200 Receptor Family in Mice and Humans and Their Interactions with CD2001 Gavin J. Wright,2,3* Holly Cherwinski,3† Mildred Foster-Cuevas,* Gary Brooke,* Michael J. Puklavec,* Mike Bigler,† Yaoli Song,† Maria Jenmalm,† Dan Gorman,† Terri McClanahan,† Man-Ru Liu,† Marion H. Brown,* Jonathon D. Sedgwick,† Joseph H. Phillips,3,4† and A. Neil Barclay3,4*

C

ell surface molecules containing Ig-like domains are one of the most abundant protein classes found in mammalian genomes (1), and the systematic characterization of these proteins expressed on leukocytes has provided many insights into their function. For example, the proteins that initiate intercellular communication by forming receptor-ligand pairs and their interactions are typified by low affinities (KD ⫽ 1–100 ␮M) when measured in the monomeric state (2). Rat CD200 (OX2) is a widely distributed cell surface protein that interacts with a receptor (CD200R) that is highly expressed on myeloid cells. Both proteins contain two extracellular Ig-like domains, but the receptor differs in that it has a longer cytoplasmic tail containing known signaling motifs (3). The CD200-deficient mouse had observable alterations in the behavior of myeloid cells in tissues that normally expressed CD200. These included both an increase in number and state of

*Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom; and †DNAX Research Institute, Palo Alto, CA 94304 Received for publication April 14, 2003. Accepted for publication July 9, 2003. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1

This work was supported by the Medical Research Council. DNAX is supported by Schering Plough. 2 Current address: Wellcome Trust Sanger Institute, Genome Campus, Hinxton, Cambridge CB10 1SA, U.K. 3

G.J.W., H.C., J.H.P., and A.N.B. contributed equally to this study.

activation of macrophages in several tissues and a profound increase in susceptibility to autoimmune disease models affecting the brain and joints. These results indicated that CD200-CD200R interactions are involved in the control of myeloid cellular function (4). The broad tissue distribution of CD200 and changes in its level of expression provide a mechanism for locally regulating myeloid cellular activity at appropriate sites, such as inflamed tissue (5, 6). The CD200-CD200R regulatory mechanism is an attractive target for immunomodulation because its manipulation can induce immune tolerance and autoimmune diseases. CD200-Fc fusion proteins have been shown to provide beneficial immunomodulatory effects in models of arthritis and allograft rejection (7, 8). In this study, we have identified the homologue of the CD200 receptor in humans, and show that it is expressed at the surface of myeloid cells and T cells and that it binds CD200. A second related gene was analyzed in humans and an additional four genes in mice that we have designated CD200 receptor-like (CD200RL)5 proteins. Two of the mouse gene products were shown to pair with the immunoreceptor tyrosine-based activation motif-containing adapter protein, DAP12, creating the potential for activating signal transduction.

Materials and Methods Cell lines and staining reagents Human mast cells were derived from freshly isolated cord blood, as previously described (9, 10). Mouse C57BL/6 mast cells were derived from bone marrow of 2- to 3-wk-old mice. Bone marrow cells were cultured in DMEM (BioWhittaker, Walkersville, MD) supplemented with 10% FCS

4

Address correspondence and reprint requests to Dr. A. Neil Barclay, Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, U.K. E-mail address: [email protected], or Dr. Joseph H. Phillips, DNAX Research, 901 California Avenue, Palo Alto, CA 94304-1104. E-mail address: [email protected] Copyright © 2003 by The American Association of Immunologists, Inc.

5 Abbreviations used in this paper: CD200RL, CD200 receptor-like; EAE, experimental autoimmune encephalomyelitis; h, human; m, mouse; RU, response unit; EST, expressed sequence tag.

0022-1767/03/$02.00

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

CD200 (OX2) is a broadly distributed cell surface glycoprotein that interacts with a structurally related receptor (CD200R) expressed on rodent myeloid cells and is involved in regulation of macrophage function. We report the first characterization of human CD200R (hCD200R) and define its binding characteristics to hCD200. We also report the identification of a closely related gene to hCD200R, designated hCD200RLa, and four mouse CD200R-related genes (termed mCD200RLa-d). CD200, CD200R, and CD200R-related genes were closely linked in humans and mice, suggesting that these genes arose by gene duplication. The distributions of the receptor genes were determined by quantitative RT-PCR, and protein expression was confirmed by a set of novel mAbs. The distribution of mouse and human CD200R was similar, with strongest labeling of macrophages and neutrophils, but also other leukocytes, including monocytes, mast cells, and T lymphocytes. Two mCD200 receptor-like family members, designated mCD200RLa and mCD200RLb, were shown to pair with the activatory adaptor protein, DAP12, suggesting that these receptors would transmit strong activating signals in contrast to the apparent inhibitory signal delivered by triggering the CD200R. Despite substantial sequence homology with mCD200R, mCD200RLa and mCD200RLb did not bind mCD200, and presently have unknown ligands. The CD200 receptor gene family resembles the signal regulatory proteins and killer Ig-related receptors in having receptor family members with potential activatory and inhibitory functions that may play important roles in immune regulation and balance. Because manipulation of the CD200-CD200R interaction affects the outcome of rodent disease models, targeting of this pathway may have therapeutic utility. The Journal of Immunology, 2003, 171: 3034 –3046.

The Journal of Immunology Analysis of the human and mouse genomes

The NCBI human and mouse genome databases were searched using BLAST (12), and corresponding genes and related genes were identified.

Ability of CD200RL proteins to pair with DAP12 cDNAs encoding full-length hCD200RLa, mCD200RLa, and mCD200RLb were subcloned into the pMX-pie retrovirus expression vector. Plasmid DNAs representing the various genes were transfected into the Phoenix ecotropic virus packaging cell line (G. Nolan), and the viruses subsequently obtained were used to infect Ba/F3-mDAP12 cells, as previously described (11). In the absence of a pairing partner, FLAG-tagged DAP12 remains within the cytoplasm of Ba/F3-mDAP12; however, if the CD200RL proteins can pair with DAP12, the FLAG epitope will appear on the cell surface of Ba/F3-mDAP12. After 1–2 wk in selection conditions, the Ba/F3-mDAP12 cells infected with the various CD200RL genes were analyzed by flow cytometry for the surface expression of the FLAG epitope of DAP12 (anti-M2 Ab; Sigma-Aldrich, St. Louis, MO). These cells were also stained with mAbs specific for the various CD200RL proteins.

CD200 binding to CD200R and CD200RL proteins Fusion proteins, consisting of the extracellular domains of mCD200 and hCD200 fused to the Fc region of hIg (mCD200-hIg, hCD200-hIg), were used to investigate the ability of the mouse and human CD200R and CD200RL proteins to bind a soluble form of CD200. Stable transfectants of Ba/F3-expressing mCD200R, hCD200R, and Ba/F3-mDAP12-expressing mCD200RLa or mCD200RLb were generated by retroviral infections, as previously described. One microgram of mCD200-hIg, hCD200-hIg, or control-hIg was used to stain ⬃106 cells of the various receptor transfectants for 20 min at 4°C. After washing, the cells were then stained with a PE-conjugated goat anti-hIg Ab (20 min at 4°C; Caltag), washed, and analyzed on a FACScan (BD Biosciences). For receptor Ab-blocking experiments, blocking mAbs against the CD200Rs were incubated with cells (2 ␮g/106 cells) for 20 min at 4°C before the addition of the mouse or human CD200-hIgs.

Cloning of hCD200R

Construction, expression, and purification of soluble recombinant proteins

The National Center for Biotechnology Information (NCBI) expressed sequence tag (EST) database was screened using the rat cDNA sequence of CD200R (GenBank accession AF231392) utilizing the BLASTN program (12). A weak match was identified in the 3⬘ nontranslated region with clone IMAGE:2054703. This clone was ordered from NCBI, and further sequencing revealed an open reading frame that contained an apparent insertion that affected the reading frame before the proposed transmembrane domain. The full-length hCD200R sequence was then amplified from cDNA generated from human lung poly(A)⫹ RNA (Clontech, Palo Alto, CA) by PCR using oligonucleotides cccactgttgatggggtaag (sense) and gactcgaggaaactgttcacacttgctcc (antisense with XhoI site underlined), and the products were reamplified in a nested PCR using the same antisense oligonucleotide, but gcagagcggccgcaaacagaaatgctc (sense) to introduce a NotI site (underlined) for cloning. Products were cloned into appropriately digested PCRScript (Stratagene, La Jolla, CA) vector, and sequencing of three clones identified two alleles that differed at 3 aa in the extracellular region (Fig. 1).

The CD200-hIg fusion proteins contain two CD200 extracellular regions, but for kinetic studies a monomeric hCD200CD4d3⫹4 was expressed by CHO.K1 cells using the expression vector pEE14 and subsequently purified from spent tissue culture medium by immunoaffinity chromatography using an OX68 mAb-Sepharose 4B column (3). Before BIAcore analysis, the purified CD200 protein was fractionated by gel filtration on a Superdex S-200 column (Pharmacia, Uppsala, Sweden) to exclude larger protein aggregates that are known to influence binding measurements. The soluble biotinylated forms of rat and mouse CD200R were produced, as described (3), and the human form was generated in an identical fashion after amplifying the entire extracellular region (including the signal sequence) using oligonucleotides gaaatctagaaaacagaaatgctctgcccttggag (sense with XbaI site underlined) and tttggcagtcgacacaggaagtagctctatgtacagactc (antisense with SalI site) in the pEF-BOS-CD4d3⫹4bio-XB vector (14). The boundary of the hCD200R protein with CD4 domain 3 was ELLPVSTSIT (CD4 linker in bold).

Measurement of affinities using surface plasmon resonance Cloning of mCD200RL genes mCD200RLa was cloned from normal bone marrow-derived mast cells using a DAP12 trap technique, as previously described (13). In brief, a cDNA library was prepared from normal mouse mast cells in a pJEF14 vector. cDNA cloning by transient expression in 293T/FLAG-DAP12 cells was performed, as previously described (13). Transfected cells were screened for cDNA-encoded proteins that were capable of pairing with DAP12 and translocating FLAG-tagged DAP12 to the cell surface. Cell surface DAP12 was then visualized using the anti-FLAG M2 mAb (Kodak, Rochester, NY) and PE-conjugated goat anti-mouse second step (Caltag, Burlingame, CA). Cells expressing surface FLAG-DAP12 were sorted on a FACS cell sorter (BD Biosciences), and plasmid DNA was recovered. After three rounds of cell sorter selection, single plasmid colonies were used for transfection, and positive clones were selected and DNA inserts sequenced. mCD200RLb was identified by homology search of the NCBI EST database and a full-length cDNA isolated by standard PCR cloning techniques from mouse bone marrow-derived mast cells. mCD200RLc was identified by homology search of the NCBI EST database. A full-length clone of mCD200RLc has not yet been isolated; however, mCD200RLc is ⬃90% identical at the amino acid level with mCD200RLa.

Affinity and kinetic data were collected using a BIAcore 2000 at 37°C, as described (3). Briefly, ⬃5,000 response units (RU) of streptavidin were coupled to a CM5 research grade chip using amine coupling. In separate experiments, biotinylated rat, mouse, or human CD200RCD4d3⫹4 proteins were immobilized at high (⬃1,600 RU), medium (⬃850 RU), and low (⬃400 RU) levels in three flow cells and control CD4d3⫹4 (⬃2,200 RU) in the fourth flow cell. Serially diluted monomeric hCD200CD4d3⫹4 purified soluble chimeric proteins were then injected at the indicated active concentrations over all four flow cells connected in series. The extinction coefficient, 40,534 M⫺1cm⫺1, was determined by amino acid analysis. The minimal fraction of purified protein able to bind the hCD200R was determined by depletion using avidin-Sepharose agarose beads (Sigma-Aldrich) coated in biotinylated rat CD200RCD4d3⫹4 as compared with biotinylated CD4d3⫹4. Depleted and control fractions were resolved by SDSPAGE and densitometrically analyzed using ImageQuant software. At least 90% of hCD200 protein could be depleted by rat CD200R, and active protein concentration was calculated by taking this into account. KD values were obtained by both nonlinear curve fitting and Scatchard transformations to the binding data. The koff binding rate constant was obtained by fitting a 1:1 binding model to the kinetic data using the BIA evaluation 3.0

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

(HyClone, Logan, UT), 1.0 mM sodium pyruvate, 0.1 mM nonessential amino acids, 0.3 mg/ml of L-glutamine, 20 mM HEPES, 50 ␮M 2-ME, 50 ng/ml of recombinant stem cell factors (PeproTech, Rocky Hill, NJ), and 30 ng/ml of murine rIL-3. After 2 wk, the cells were cultured in RPMI 1640 medium containing the same supplements as above minus the stem cell factor, but with the addition of 5 ng/ml of murine rIL-4. Ba/F3, a pro-B cell line, was kindly provided by T. Kitamura (University of Tokyo, Tokyo, Japan). A cDNA containing the CD8 leader segment followed by the FLAG peptide epitope and joined to the extracellular, transmembrane, and cytoplasmic domains of mouse DAP12 (mDAP12) was subcloned into the retroviral vector pMX-neo (11). Plasmid DNA of this construct was transfected into the Pheonix ecotropic virus packaging cell line (G. Nolan, Stanford University, Stanford, CA), and viruses obtained were used to infect Ba/F3 cells. Ba/F3-mDAP12 cells stably express cytoplasmic FLAGtagged mDAP12. Mouse and human peripheral blood leukocytes were prepared from peripheral blood by hypotonic lysis of RBC. Mouse splenic leukocytes were prepared from single cell suspensions after hypotonic lysis of RBC. The following anti-mouse leukocyte Abs were obtained from BD Biosciences (San Jose, CA): FITC-DX5, FITC-CD4, FITC-CD8, FITC-CD19, FITC-CD11b, and CyChrome-CD3. The following anti-human leukocyte Abs were obtained from BD Biosciences: FITC-CD3, FITC-CD4, FITCCD8, FITC-CD19, FITC-CD14, FITC-CD16, CyChrome-CD56, CyChrome-CD3,andCyChrome-CD14.FITC-conjugatedanti-humanIgE(antihIgE) was obtained from Kirkegaard & Perry Laboratories (Gaithersburg, MD). Anti-mouse CD200R (DX109, rat IgG1, OX110, rat IgG1), antimouse CD200RLa (DX87, rat IgG2c), and anti-mouse CD200RLb (DX116, rat IgG1) were generated from rats using immunogenic fusion proteins consisting of the extracellular domains of the various CD200R genes fused to the Fc domain of hIg (mCD200R-hIg, mCD200RLa-hIg, mCD200RLb-hIg), except for OX110, in which mCD200RCD4d3⫹4 was used. Anti-human CD200R (DX136, rat IgG2a) was generated from a rat immunized with a fusion protein consisting of the extracellular domain of hCD200R fused to the Fc domain of hIg (hCD200R-hIg). Anti-human mCD200R (OX108, mouse IgG1) was generated from a BALB/c mouse immunized with hCD200RCD4d3⫹4 (see below).

3035

3036

HUMAN AND MOUSE CD200 RECEPTOR

software, and these data are shown in Table I. In addition, koff rate constants were also determined by fitting a first order exponential decay curve to normalized data over the dissociation phase (see Fig. 4c), and these were in good agreement.

Tissue expression of CD200R and related genes by mRNA analysis

Flow cytometry Flow cytometric analysis was performed on freshly isolated peripheral blood leukocytes from normal 5- to 7-wk C57BL/6 mice, normal human peripheral blood leukocytes, and human monocyte-derived dendritic cells, as previously described (16). C57BL/6 splenocytes were also analyzed for the expression of mCD200R and mCD200RL proteins. Cells were incubated with biotinylated rat mAbs specific for mouse or human CD200 receptor family members (or appropriate isotype controls) for 20 min at 4oC, washed, and then stained with a PE-conjugated streptavidin (CalTag, Burlingame, CA). After blocking with a cocktail of mouse and rat serum, the cells were incubated for 20 min with FITC-conjugated and CyChromeconjugated mAbs against leukocyte differentiation Ags, after which the cells were washed, fixed, and analyzed using a FACScan (BD Biosciences).

Results Cloning and sequence analysis of the hCD200R EST databases were screened using rat CD200R cDNA, and a candidate sequence for the hCD200R was identified and named hCD200R. cDNA clones were isolated from human lung cDNA by PCR, and sequencing revealed two alleles that differed at 3 aa in

Table I. Kinetic data for hCD200-binding human, rat, and mouse CD200Ra Kinetics hCD200 Binding to:

Human CD200R Rat CD200R Mouse CD200R

KD (␮M)

Off Rate (s⫺1)

t1/2 (s)

0.49 ⫾ 0.08 0.59 ⫾ 0.07 7.0 ⫾ 0.33

0.09 ⫾ 0.004 0.24 ⫾ 0.03 2.10 ⫾ 0.2

7.7 2.9 0.3

a The KD values were determined by averaging those calculated from each of the three different CD200R immobilization levels obtained by nonlinear curve fitting (note that the curves shown in Fig. 4B are from high levels of human CD200R immobilization alone). The koff values were determined by averaging the values obtained by fitting the dissociation phases of the binding curves to a simple 1:1 binding model (see Materials and Methods) using two different concentrations of ligand over three levels of receptor immobilization (i.e., n ⫽ 6). In all cases, the level of receptor immobilization had negligible effects on koff, indicating that mass transport and rebinding effects were minimal.

Analysis of the interaction between CD200 and CD200R in human, mouse, and rat To analyze the ability of mouse and human CD200R to bind CD200, we used soluble fusion proteins consisting of the extracellular domains of mouse and human CD200 fused to the Fc binding domain of hIg and Ba/F3 cell transfectants expressing either mCD200R or hCD200R. As shown in Fig. 3, mCD200 and hCD200 bound to their respective receptors, and ligand binding could be completely blocked by specific mAb to these receptors (see below). The interaction between human CD200R and CD200 was characterized biochemically by making recombinant proteins corresponding to their extracellular regions and quantified in real time using surface plasmon resonance in a BIAcore (14). hCD200R-CD4d3⫹4-biotin protein and a negative control (CD4d3⫹4-biotin) were immobilized in separate flow cells on a streptavidin-coated sensor chip before injecting purified soluble hCD200-CD4d3⫹4 protein. hCD200CD4d3⫹4 bound to the hCD200R-CD4d3⫹4 flow cell in comparison with the control reference cell (Fig. 4A). This binding was quantified by calculating the difference in RU observed in the hCD200R and control flow cells once equilibrium had been reached and is plotted as a binding curve (Fig. 4B). The equilibrium-binding affinities (KD) were calculated both by nonlinear curve fitting (Fig. 4B) and Scatchard transformations (Fig. 4B, inset) of the binding data giving similar values. The CD200 interacted with the hCD200R with an equilibrium-binding affinity of ⬃0.5 ␮⌴ at 37°C. Kinetic analysis of the interaction yielded an off rate ⬃0.1 s⫺1 ⫺ (equivalent to a t1/2 of 7 s) at different levels of hCD200R immobilization, indicating that kinetic measurements were not grossly affected by rebinding or mass transport effects (Fig. 4C). These measurements were repeated using soluble biotinylated forms of both the rat and mouse CD200R produced in an identical manner, and the data are presented in Table I. This revealed that the hCD200 interacted with CD200R with similar kinetics to the equivalent interaction in rats and mice. hCD200 showed some cross species binding to both mouse and rat CD200R, but binding to mCD200R was weaker, with about a 10-fold faster dissociation rate that explained why hCD200-hIg did not bind mCD200R (data not shown).

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

For the determination of gene expression, previously described cDNA libraries generated from a variety of mouse and human cell types and tissues were used (15). Gene expression was determined by real-time quantitative PCR using an ABI GeneAmp 5700 sequence detection system and the reporter fluorescent dye, SYBR (PerkinElmer Applied Biosystems, Foster City, CA). In brief, 20 ng of cDNA in PCR buffer contained 200 ␮M dATP, dCTP, and dGTP; 400 ␮M dUTP; 4 mM MgCl2; 1.25 U of AmpliTaq DNA polymerase; 0.5 U Amp-Erase uracil-N-glycocylase; 900 nM of each primer; and 250 nM probe. The thermal cycling conditions were: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of amplification at 95°C for 15 s and 60°C for 1 min for denaturing and anneal extension, respectively. PCR amplification of the housekeeping gene ubiquitin was performed for each sample to control for sample loading and to allow for normalization between samples, according to the manufacturer’s instructions (PerkinElmer). Each data point was evaluated for integrity by analysis of amplification plots and dissociation curves and the ubiquitin normalized data were expressed as the fold gene expression. Primers used in this study were designed with Primer Express software (PerkinElmer). The following primers were used (sense primer is given first): mCD200R, AGGAG GATGAAATGCAGCCTTA, TGCCTCCACCTTAGTCACAGTATC; mCD200RLa, GGAGGACTCTGGCTTTGATGTTA, CCCGTCCTTTCAC TGAACAAC; mCD200RLb, CCATAGAACTGAGTCAAGGTACAATGA, TCCTACGTTAAGAAGAATAATCACCAAA; hCD200R, TGGGAGGTC CACAATGTGTCTA, TGTACAGACTCTTGTTGCCAGTCA.

the extracellular region (Fig. 1). In addition, an alternative variant (hCD200Ri) was identified that contained an extra segment of sequence contiguous to the signal peptide that corresponded to an exon and thus presumably represents an alternatively spliced variant cDNA (Fig. 1). The hCD200R is a type I cell surface glycoprotein containing two Ig-like domains in the common V/C2 set arrangement (17) with a hydrophobic transmembrane sequence and a substantial cytoplasmic region. A comparison of this sequence with that of the rodent CD200 receptors showed that all the extracellular cysteine residues were conserved and the protein was also highly glycosylated, containing eight potential N-linked glycosylation sites (Fig. 1). All three tyrosine residues that are predicted to lie in the cytoplasmic portion of the molecule were also conserved, and the rat protein has been shown to be phosphorylated upon pervanadate treatment (3). Phylogenetic analysis of CD200R and proteins shown to have the highest levels of similarity from database searches revealed some sequence similarity to the ligand, CD200, and other Ig superfamily members (Fig. 2), as reported previously (3). hCD200R showed closest similarity to human herpesvirus entry protein HveC and related proteins HveB (nectin2) and HveD (poliovirus receptor or CD155). HveC, previously known as poliovirus-related protein PRR1, permits entry of herpes simplex viruses through interaction with the envelope glycoprotein D (18, 19).

The Journal of Immunology

3037

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

FIGURE 1. The human and mouse CD200R and related sequences. The hCD200R sequences have been aligned to the rodent orthologs (accession AF231392 and AF231393), and the sequence has been split according to predicted domain organization. The NH2 terminus is based on protein data for rat CD200R. The superscript bars predict the extent of the ␤-strands characteristic of the Ig fold by comparison with solved structures. The sequence of the allele used in all binding experiments is shown with the three positions of allelic polymorphism shown above the sequence (accession AF283760). The form with an additional spliced exon is termed CD200Ri (accession NM 138806), and only the extra sequence is shown as other residues are identical with hCD200R. A second human gene termed CD200RLa was identified by EST and cDNA analysis. Additional mouse genes include two forms isolated through their association with DAP12 (mCD200RLa and mCD200RLb; accession XM156177 and XM148097). Residues identical in four or more sequences are boxed (three for cytoplasmic regions) apart from CD200Ri form, as this is known to be a splice variant and CD200RLc and CD200RLb (incomplete sequences). One sequence, CD200RLc, was only isolated as a partial cDNA clone, and additional residues were deduced from genomic sequence and are shown in italics. The partial sequence CD200RLd was only identified as genomic sequence and is shown in italics. Potential N-linked glycosylation sites (N) and the lysine residue (K) in the transmembrane are shown in bold.

Identification and structural characterization of genes related to CD200R in mice and humans In addition to the mCD200R cloned previously (3), two cDNAs for genes closely related to CD200R were isolated from normal bone marrow-derived mouse mast cells. These two proteins, named mCD200RLa and mCD200RLb, showed extensive sequence similarity in the extracellular regions to the mCD200R, but displayed

short cytoplasmic regions devoid of known signaling motifs. Unlike mCD200R, the transmembrane regions of these two genes contained a positively charged amino acid, lysine (Fig. 1). Because mCD200RLa was also isolated by DAP12 trapping (see Materials and Methods), the lysine in the transmembrane was expected to form a salt bridge with DAP12, allowing these proteins to pair. Transduction of mCD200RLa and mCD200RLb into Ba/F3 cells

3038

HUMAN AND MOUSE CD200 RECEPTOR

FIGURE 2. Phylogenetic analysis of CD200R. The extracellular two Ig-like domains of hCD200R; hCD200; human herpesvirus entry proteins HveB, C, and D; and other hIg-like proteins (CD56, CD80, and CD86) were aligned using ClustalW (42), manually refined, and then a NeighborJoining tree constructed with 1000 bootstrap trials. In Hve proteins and CD56, only the membrane distal two domains were compared.

stably expressing a FLAG-tagged murine DAP12 resulted in the cell surface expression of DAP12 and the associated CD200RL proteins (Fig. 5). Immunoprecipitation experiments using mAbs against mCD200RLa and mCD200RLb further verified that these two genes are naturally pairing with DAP12 in normal mouse mast cells (data not shown). A fourth form (mCD200RLc) was also identified from EST database analysis, which has a high degree of identity to mCD200RLa and also contains a positively charged

FIGURE 3. Flow cytometry showing binding of CD200-Ig to mCD200R and hCD200R. Ba/F3 cells expressing either the human (A) or the mouse (D) CD200R were stained with anti-CD200R mAbs or isotype controls, followed by a goat anti-rat PE-conjugated secondary Ab. CD200-Ig or control Igs were allowed to bind to CD200R-expressing Ba/F3 cells in the presence of a control Ab (B, E) or specific anti-CD200Rblocking Abs (C, DX136; F, DX109). The CD200 Igs were detected with a monoclonal rat anti-human PEconjugated secondary reagent that did not cross-react with mouse or rat IgG, and analyzed by flow cytometry.

Distribution of CD200R and CD200RL gene products by mRNA analysis The distribution of CD200R was determined by a highly sensitive quantitative RT-PCR method in a panel of cDNA libraries from a variety of purified cell types and normal tissues from both mice and humans (Figs. 7 and 8). Using PCR primers that specifically identify CD200R mRNA, it was clear that CD200R shared a similar cellular and tissue distribution in both species. The highest levels of expression were observed in bone marrow-derived macrophages from the mouse, and monocyte-derived dendritic cells in humans. Significant gene expression, however, was also seen in polarized Th2 T cells, mast cells, and dendritic cells of both mice and humans. Interestingly, although mouse bone marrow-derived macrophages expressed very high levels of CD200R mRNA, freshly isolated human peripheral blood monocytes expressed only low levels of CD200R mRNA. The differentiation status of these particular cell types is, however, not comparable, and it is thus

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

amino acid in the transmembrane domain, again suggesting pairing with DAP12. A full-length cDNA of mCD200RLc, however, has not yet been isolated. A fifth partial gene sequence, mCD200RLd, was also identified in the mouse genome (Fig. 1), and the arrangement of the genes on chromosome 16 is shown in Fig. 6. All five members of the mCD200 receptor gene family are located on a short section of chromosome 16 (⬃200 kbp) and within ⬃400 kbp of the CD200 gene itself. In contrast to the mouse genome, analysis of the human genome showed only two CD200R-like genes: one corresponding to the CD200R form originally described in mouse and rat (3), and a second, termed hCD200RLa, which showed the most sequence homology to the mCD200RLa. hCD200RLa contains a short cytoplasmic region, and the charged residue in the transmembrane suggests that it can also interact with DAP12. The human CD200, CD200R, and CD200RL genes are located on chromosome 3, agreeing with previous cytogenetic analysis for CD200 (20). Interestingly, although both CD200 and its receptor are transcribed in the same direction in humans, this is not the case in mice (Fig. 6). Given the similarities in sequence, it seems likely that the CD200RL genes evolved from recent gene duplications and that these and CD200 evolved from a common ancestral precursor.

The Journal of Immunology

3039

FIGURE 4. The equilibrium affinity and kinetics of hCD200R interacting with hCD200 protein. A, The indicated active concentrations (␮M) of hCD200CD4d3⫹4 were injected at 15 ␮l/min and 37°C through flow cells with 1815 RU of hCD200RCD4d3⫹4-biotin (solid line) or 2185 RU of CD4d3⫹4-biotin (control dotted line) immobilized. The amount of hCD200CD4d3⫹4 that bound at each concentration was calculated as the difference between the response at equilibrium in the hCD200RCD4d3⫹4 and control flow cells, and these are plotted as binding curves (B). B, The curved lines in the main plot are nonlinear curve fits to the data and correspond to an affinity of 0.5 ␮M. A Scatchard transformation of the same binding data is shown inset in B, and the linear fit shown corresponds to a KD of 0.5 ␮⌴. C, The dissociation rate constant of the hCD200-hCD200R interaction was measured by injecting 10 ␮l of soluble hCD200CD4d3⫹4

possible that CD200R expression is up-regulated on tissue macrophages. B cells, fibroblasts, and endothelial cells from both mice and humans expressed little, if any, detectable CD200R mRNA. In whole tissues, the highest expression of CD200R mRNA was observed in bone marrow, lymph nodes, spleen, and lung, while the lowest expression was seen in liver, spinal cord, and kidney (Figs. 7 and 8). Tissue macrophages of the CNS (microglia) are known to express low levels of CD200R in the rat (3); however, in whole spinal cord tissues, the level of mRNA contributed by these cells was negligible. The thymus was the only tissue that showed differential expression between mice and humans. Mouse thymus showed significant expression of CD200R mRNA, whereas human thymus had essentially undetectable levels. The cellular distribution of mCD200RLa and mCD200RLb was also quantified by PCR on the same panel of mouse cDNA libraries (Fig. 7). The highest level of mCD200RLa was observed in unstimulated mast cells. This expression was, however, significantly decreased in mast cells triggered via Fc⑀RI. Strong mCD200RLa expression was also seen in bone marrow-derived

(2.0 ␮M) at 100 ␮l/min over immobilized hCD200RCD4d3⫹4-biotin at high (1815 RU) and medium (895 RU) levels and also a negative control CD4d3⫹4-biotin (2185 RU), and data were collected at 10 Hz. The data were then normalized (100% at the start of the dissociation phase), and first order exponential decay curves were fitted to the dissociation data (hCD200R medium) and yielded a koff value of 0.09 s1. For clarity, only every tenth data point is shown.

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

FIGURE 5. mCD200RLa and mCD200RLb can associate with DAP12. Ba/F3 cells stably expressing FLAG-tagged murine DAP12 were infected with either mCD200RLa or mCD200RLb containing retroviruses. Transduction of mCD200RLa or mCD200RLb into these cells resulted in the pairing of these receptors with FLAG-tagged DAP12 and the cell surface expression of the complexes. This was confirmed by flow cytometry using either an anti-FLAG Ab or mAbs specific for mCD200RLa or mCD200RLb. A, BaF3 cells stably expressing murine DAP12 were stained with control Ab (- - - -) or anti-FLAG Ab (䡠 䡠 䡠 䡠 䡠). B, Ba/F3-DAP12 cells infected with murine CD200RLa were stained with control Ab (- - - -), antiFLAG Ab (䡠 䡠 䡠 䡠 䡠), or anti-mCD200RLa Ab (——). C, Ba/F3-DAP12 cells infected with murine CD200RLb were stained with control Ab (- - - -), antiFLAG Ab (䡠 䡠 䡠 䡠 䡠), or anti-mCD200RLb Ab (——).

3040

HUMAN AND MOUSE CD200 RECEPTOR

FIGURE 6. Organization of CD200 and receptor genes in the human and mouse genomes. The approximate positions of the CD200 and CD200R and related genes are shown as oblongs in their approximate positions on the genome. The numbering of the bases is from the current NCBI human and mouse databases. Arrows indicate direction of transcription.

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

FIGURE 7. Expression of mCD200R, mCD200RLa, and mCD200RLb by mRNA analysis in various cell lines (A) and tissues from C57BL/6 mice (B). Results are presented as fold expression relative to normalized ubiquitin levels.

The Journal of Immunology

3041

macrophages and dendritic cells, and to a lesser extent in polarized Th2 T cells. mCD200RLb, however, was primarily expressed in mast cells and polarized Th2 T cells and to a lesser degree in bone marrow-derived dendritic cells. Unlike mCD200R and mCD200RLa, mCD200RLb was undetectable in bone marrow-derived macrophages and was expressed at relatively low levels in bone marrow-derived dendritic cells. cDNA for hCD200RLa was isolated from peripheral blood, but was not found in significant levels in cDNA libraries. Analysis of the amino acid sequence revealed that it lacked two cysteines when compared with the mouse homologue and other genes in this group (Fig. 1). This may explain why hCD200RLa was not expressed even in the presence of DAP12, DAP10, Fc⑀R1␥, or CD3␥. Indeed, reintroducing the cysteine residues restored expression in the presence of DAP12 (G. Brooke, unpublished data). It is likely therefore that hCD200RLa is nonfunctional in humans. Distribution of mouse and human CD200R by mAb staining mAb specific for mCD200R and hCD200R were generated to investigate the cellular distribution of the CD200R protein. In mouse peripheral blood, mCD200R (DX109) was strongly expressed on all granulocytes (CD11b⫹, Gr-1⫹⫹) and monocytes (CD11b⫹⫹,

Gr-1⫺) with weaker labeling of most T cells (CD3⫹) (Fig. 9). T cell staining for CD200R was primarily restricted to CD4⫹ T cells (data not shown). Weak mCD200R expression was observed on a subset of NK cells (DX5⫹, CD3⫺), NKT cells (CD3⫹, DX5⫹), and B cells (CD19⫹). In the spleen, mCD200R showed an identical cellular expression pattern to that observed in the peripheral blood, although with somewhat higher levels of expression of CD200R on splenic T cells (data not shown). Consistent results were obtained with another rat anti-mouse CD200R mAb OX110 (data not shown). In human peripheral blood, hCD200R (DX136) displayed a similar cellular distribution to that observed in mouse peripheral blood (Fig. 10). The majority of human peripheral blood T cells (both CD8⫹ and CD4⫹), all neutrophils (CD14⫹⫹, CD16⫹⫹), and all basophils (CD9⫹⫹, Fc⑀RI⫹⫹; data not shown) expressed high levels of hCD200R. Similar to mouse peripheral blood, the majority of human monocytes expressed moderate levels of hCD200R; this expression was significantly up-regulated when monocytes were induced to differentiate into dendritic cells in vitro (CD14⫹/⫺, HLA-DR⫹⫹) in the presence of GM-CSF and IL-4 (data not shown). The majority of NK cells (CD56⫹, CD3⫺) did not express hCD200R. Low levels of hCD200R expression, however, were

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

FIGURE 8. Expression of hCD200R by mRNA analysis in various cell lines (A) and normal human autopsy tissues (B). Results are presented as fold expression relative to normalized ubiquitin levels.

3042

HUMAN AND MOUSE CD200 RECEPTOR

observed on a subset of the CD56 bright NK cells (CD56⫹⫹, CD3⫺) as well as NKT cells (CD56⫹, CD3⫹). A small subset of B cells (CD19⫹) demonstrated hCD200R expression in most donors analyzed. hCD200R was not expressed on freshly isolated peripheral blood platelets or RBC (data not shown). Similar results were obtained with an anti-human mCD200R mAb OX108 (data not shown). Distribution of mouse CD200RLa and CD200RLb by mAb staining Rat mAb specific for mCD200RLa (DX87) and mCD200RLb (DX116) were generated to investigate the expression of these proteins on mouse leukocytes. Unlike mCD200R, mCD200RLa was not expressed on T cells (Fig. 11). Strong expression of mCD200RLa was observed on NK cells, monocytes, and a subset of NKT cells, while low expression was seen on B cells and granulocytes. Although data for peripheral blood leukocytes are shown, similar expression patterns were also observed on splenic populations of leukocytes (data not shown). mCD200RLb, although strongly expressed on bone marrow-derived mast cells (data not shown), was not significantly expressed on peripheral blood leukocytes (Fig. 11).

Binding of mCD200 to mCD200RLa and mCD200RLb To analyze the ability of mCD200 to bind mCD200RLa and mCD200RLb, we used soluble fusion proteins consisting of the extracellular domains of mCD200 fused to the Fc binding domain of hIg and Ba/F3 cell transfectants expressing either mCD200RLa or mCD200RLb. Although mCD200-hIg readily bound to transfectants expressing the mCD200R protein (Fig. 3), we were unable to demonstrate any significant binding of mCD200 to either the mCD200RLa or mCD200RLb proteins (data not shown). Attempts to demonstrate mCD200 binding to these receptors by varying mCD200 concentrations, binding times, and binding temperatures have also failed to show specific receptor binding. Presumably, mCD200RLa and mCD200RLb bind alternative ligands despite the relatively high sequence similarity to the mCD200R.

Discussion We report on the characterization of the CD200 receptor family in both humans and mice. Analysis of the human and mouse genomes together with cDNA sequence analysis indicates that there has been extensive gene duplication in the CD200R genes with up to five related genes in mice on chromosome 16 and two genes in humans on chromosome 3. The human homologue of mCD200R,

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

FIGURE 9. Expression of mCD200R by flow cytometric analysis of peripheral blood leukocytes. A, Mouse peripheral blood leukocytes were stained with FITC-conjugated anti-DX5, CyChrome-conjugated anti-CD3, and biotinylated isotype control Abs or biotinylated anti-mCD200R (followed by PE-conjugated streptavidin), and then electronically gated by forward and 90° light scatter on lymphocytes (A). Various leukocyte populations were isolated by specific phenotype gating and analyzed for the expression of isotype control (- - - -) and anti-mCD200R (——). The following leukocyte populations were studied: NK cells were DX5⫹, CD3⫺; NKT cells were DX5⫹, CD3⫹; T cells were CD3⫹; and B cells were DX5⫺, CD3⫺ (⬎93% CD19⫹; data not shown). B, Mouse peripheral blood leukocytes were stained with FITC-conjugated anti-CD11b, CyChrome-conjugated Gr-1, and biotin-conjugated isotype control Ab or biotinconjugated anti-mCD200R (followed by PE-conjugated streptavidin). Monocytes were identified by forward and 90° light scatter and were phenotype gated as CD11b⫹, Gr-1⫺ (data not shown). Granulocytes were also identified by distinctive forward and 90° light scatter and were phenotype gated, CD11b⫹ Gr-1⫹⫹ (data not shown). Monocytes and granulocytes were analyzed for the expression of isotype control Ab (- - - -) and mCD200R (——).

The Journal of Immunology

3043

designated hCD200R, shows a high degree of sequence and structural similarity to its mouse counterpart, and indeed interacts with hCD200 protein in an analogous manner to that reported in rodents (3). Of particular interest are the highly conserved tyrosines and associated amino acids in the cytoplasmic domain of both mouse and human CD200R. The high degree of identity in the tyrosinerich regions of the cytoplasmic tails of mCD200R and hCD200R suggests that these proteins recruit similar signal transduction machinery. The molecular identity of the cytoplasmic receptor signaling proteins is presently unknown; however, both mouse and human CD200R have a conserved phosphotyrosine binding site for Shc (NPXY) in the cytoplasmic domains (21, 22). Studies are presently underway to delineate the mechanisms and the structural requirements for signal transduction via the CD200R.

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

FIGURE 10. Expression of hCD200R by flow cytometry of peripheral blood leukocytes. A, Human peripheral blood leukoctyes were stained with FITCconjugated anti-CD3, CyChrome-conjugated antiCD56, and biotinylated isotype control Abs or biotinylated anti-hCD200R (followed by PE-conjugated streptavidin) and then electronically gated by forward and 90° light scatter on lymphocytes (A). Various leukocyte populations were identified by specific phenotype gating and analyzed for the expression of isotype control (- - - -) and anti-hCD200R (——). The following leukocyte populations were studied: NK cells, CD56⫹, CD3⫺; CD56 bright NK cells, CD56⫹⫹, CD3⫺; T cells, CD3⫹; NKT cells, CD56⫹, CD3⫹; and B cells, CD56⫺, CD3⫺, ⬎90% CD19⫹ (not shown). B, Human peripheral blood leukocytes were stained with FITC-conjugated antiCD14, CyChrome-conjugated CD16, and biotinconjugated isotype control Ab or biotin-conjugated anti-hCD200R (followed by PE-conjugated streptavidin). Monocytes were identified by forward and 90° light scatter and were phenotype gated as CD14⫹, CD16⫺ (data not shown). Granulocytes were also identified by distinctive high forward and 90° light scatter and were phenotype gated as CD14⫺ CD16⫹⫹ (not shown). Monocytes and granulocytes were then analyzed for the expression of isotype control Ab (- - - -) and hCD200R (——).

Analysis of mRNA expression in mouse and human cDNA libraries reveals that CD200R is expressed in a variety of cell types of the myeloid/monocytic lineage, in particular, macrophages, dendritic cells, and mast cells. Interestingly, CD200R mRNA is also highly expressed in polarized Th2 T cells in both mice and humans, indicating that this receptor may have a more extensive immunological role than previously anticipated because it has a broader distribution than observed with the original anti-rat CD200R mAb (3). mAbs specific for mCD200R and hCD200R were generated to investigate the expression of CD200R protein on freshly isolated leukocyte populations. In both mice and humans, CD200R is prominently expressed on peripheral blood neutrophils. Because neutrophils play a major role in most inflammatory responses (23), the high expression levels of CD200R suggest that

3044

HUMAN AND MOUSE CD200 RECEPTOR

this receptor may play an important regulatory role in neutrophil biology; this concept has been reviewed (5). Experiments are presently underway to investigate the functional role of CD200R in neutrophil phagocytosis, superoxide production, and chemokine responses. As expected from the mRNA distribution analysis, CD200R is also expressed on freshly isolated CD4⫹ T cells from mouse and human peripheral blood. The mRNA analysis showed a restricted expression of CD200R to polarized Th2 cells; however, cellular expression of the protein indicates that the majority of CD4⫹ T cells in the mouse and human peripheral blood expressed CD200R. It is possible that CD200R is down-regulated by the cytokines required to polarize Th1 cells, while remaining stably expressed on committed Th2 cells. The expression of CD200R on Th2 cells has important implications for immune regulation. Th2 cells have been strongly implicated in variety of pathological conditions, including allergy, asthma, and hypersensitivity (24 –27). Proinflammatory cytokines, such as IL-3, IL-4, IL-5, IL-13, and GM-CSF, are produced by Th2 cells and are believed to be the major factors in allergic pathologies, such as inflammation, mucous hypersecretion, and airway constriction. The strong expression of CD200R, an inhibitory receptor, on Th2 cells may indicate that this receptor plays an important regulatory role in Th2-mediated responses. The expression of CD200R on Th2 cells also suggests that therapeutic strategies directed toward triggering CD200R on Th2 cells may function to inhibit allergic inflammation and associated pathologies. The distribution of CD200R and related proteins is summarized in Table II.

Our previous studies in the mouse have implicated CD200R in the regulation of normal macrophage/myeloid function (3, 4). Consistent with these earlier studies, mCD200R was strongly expressed on peripheral blood monocytes and splenic macrophages. Indeed, preliminary immunocytochemistry analysis demonstrates the expression of CD200R on subsets of macrophages from normal mouse skin, lung, and intestine. mAb staining in the mouse clearly shows that, although CD200R is associated with the macrophage/

Table II. Summary of tissue distribution of human and mouse CD200R and related proteinsa Tissue

hCD200R

mCD200R

mCD200RLa

mCD200RLb

Monocytes Granulocytes Dendritic cells Macrophage Mast cells T cells T cell clones Th1 T cell clones Th2 B cells NK cells NKT

⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹ ⫹ ⫹⫹ ⫹ ⫹⫹ ⫹/⫺ ⫺ ⫹

⫹⫹⫹ ⫹⫹⫹ ⫹ ⫹⫹⫹ ⫹⫹ ⫹⫹ ⫺ ⫹ ⫹ ⫺ ⫹

⫹⫹⫹ ⫹/⫺ ⫹ ⫹⫹ ⫹⫹ ⫺ ⫺ ⫹/⫺ ⫹ ⫹⫹ ⫹

⫹/⫺ ⫺ ⫹ ⫺ ⫹⫹ ⫺ ⫺ ⫹ ⫹ ⫺ ⫺

a Compilation of data from expression studies by mRNA analysis and mAb staining on normal tissues and cell lines (see Figs. 7–11). Human macrophage data are from skin (data not shown).

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

FIGURE 11. Expression of mCD200RLa and mCD200RLb by flow cytometric analysis of mouse peripheral blood leukocytes. Mouse peripheral blood leukocyte subsets were identified and phenotype gated, as described in Fig. 9. Specific leukocyte populations were then analyzed for the expression of isotype control Abs (- - - -), anti-mCD200RLa (——), and anti-mCD200RLb (- 䡠 - 䡠 -). The following leukocyte populations were analyzed for the expression of mCD200RLa and mCD200RLb: T cells, CD3⫹; NKT cells, CD3⫹, DX5⫹; NK cells, CD3⫺, DX5⫹; B cells, CD3⫺, DX5⫺; monocytes, CD11b⫹, Gr-1⫺; and granulocytes, CD11b⫹, Gr-1⫹⫹.

The Journal of Immunology

there is clearly a form that can give an activating signal through DAP12, and in this regard it resembles other gene families such as signal regulatory proteins and killer Ig-related receptors that have both activating and inhibitory forms (38 – 41). Manipulating the CD200R has been shown to affect immune responses, but these data indicate that the cells being affected may include both myeloid cells and T cells. Importantly, the definition of a family of closely related CD200R-like proteins (at least in the mouse) suggests that different effects in vivo and in vitro may be expected using CD200-Fc fusion proteins, shown in this study to be specific for CD200R, and Abs against the various related members that may show different cross-reactivities.

Acknowledgments We are grateful to Tony Willis for amino acid analysis, and Sandra Zurawski, Janet Wagner, and Lisa Oldham for the construction and purification of CD200-Ig fusion proteins.

References 1. Barclay, A. N. 2003. Membrane proteins with immunoglobulin-like domains: a master superfamily of interaction molecules. Semin. Immunol. 15:215. 2. Van der Merwe, P. A., and A. N. Barclay. 1996. Analysis of cell-adhesion molecule interactions using surface plasmon resonance. Curr. Opin. Immunol. 8:257. 3. Wright, G. J., M. J. Puklavec, A. C. Willis, R. M. Hoek, J. D. Sedgwick, M. H. Brown, and A. N. Barclay. 2000. Lymphoid/Neuronal cell surface OX2 glycoprotein recognizes a novel receptor on macrophages implicated in the control of their function. Immunity 13:233. 4. Hoek, R. M., S. R. Ruuls, C. A. Murphy, G. J. Wright, R. Goddard, S. M. Zurawski, B. Blom, M. E. Homola, W. J. Streit, M. H. Brown, et al. 2000. Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science 290:1768. 5. Nathan, C., and W. A. Muller. 2001. Putting the brakes on innate immunity: a regulatory role for CD200? Nat. Immun. 2:17. 6. Barclay, A. N., G. J. Wright, G. Brooke, and M. H. Brown. 2002. CD200 and membrane protein interactions in the control of myeloid cells. Trends Immunol. 23:285. 7. Gorczynski, R. M., Z. Chen, K. Yu, and J. Hu. 2001. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clin. Immunol. 101:328. 8. Gorczynski, R. M., M. S. Cattral, Z. Chen, J. Hu, J. Lei, W. P. Min, G. Yu, and J. Ni. 1999. An immunoadhesin incorporating the molecule OX-2 is a potent immunosuppressant that prolongs allo- and xenograft survival. J. Immunol. 163:1654. 9. Valent, P., E. Spanblochl, W. R. Sperr, C. Sillaber, K. M. Zsebo, H. Agis, H. Strobl, K. Geissler, P. Bettelheim, and K. Lechner. 1992. Induction of differentiation of human mast cells from bone marrow and peripheral blood mononuclear cells by recombinant human stem cell factor/kit-ligand in long term culture. Blood 80:2237. 10. Mitsui, H., T. Furitsu, A. M. Dvorak, A. M. A. Irani, L. B. Schwartz, N. Inagaki, M. Takei, K. Ishizaka, K. M. Zsebo, S. Gills, and T. Ishizaka. 1993. Development of human mast cells from umbilical cord blood cells by recombinant human and murine c-kit ligand. Proc. Natl. Acad. Sci. USA 90:735. 11. Onihsi, M., S. Kinoshi, Y. Morikawa, A. Shibuya, J. H. Phillips, L. L. Lanier, D. Gorman, G. P. Nolan, A. Miyajima, and T. Kitamura. 1996. Applications of retrovirus-mediated expression cloning. Exp. Hematol. 24:324. 12. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403. 13. Bakker, A. B., E. Baker, G. R. Sutherland, J. H. Phillips, and L. L. Lanier. 1999. Myeloid DAP12-associating lectin (MDL)-1 is a cell surface receptor involved in the activation of myeloid cells. Proc. Natl. Acad. Sci. USA 96:9792. 14. Brown, M. H., K. Boles, P. A. van der Merwe, V. Kumar, P. A. Mathew, and A. N. Barclay. 1998. 2B4, the NK and T cell immunoglobulin superfamily surface protein is a ligand for CD48. J. Exp. Med. 188:2083. 15. Halfon, S., J. Ford, J. Foster, L. Dowling, L. Lucian, M. Sterling, Y. Xu, M. Weiss, M. Ikeda, D. Liggett, et al. 1998. Leukocystatin, a new class II cystatin expressed selectively by hematopoietic cells. J. Biol. Chem. 273:16400. 16. Vassili, S., P. A. Reche, H. Kanzler, W. Yuan, G. Edward, B. Homey, M. Gilliet, S. Ho, S. Antonenko, A. Lauerma, et al. 2002. Human epithelial cells trigger dendritic cell-mediated allergic inflammation by producing TSLP. Nat. Immun. 3:673. 17. Barclay, A. N., M. H. Brown, S. K. A. Law, A. J. McKnight, M. G. Tomlinson, and P. A. van der Merwe. 1997. Leucocyte Antigens Factsbook, 2nd Ed. Academic Press, London. 18. Geraghty, R. J., C. Krummenacher, G. H. Cohen, R. J. Eisenberg, and P. G. Spear. 1998. Entry of alphaherpesviruses mediated by poliovirus receptorrelated protein 1 and poliovirus receptor. Science 280:1618. 19. Lopez, M., F. Cocchi, L. Menotti, E. Avitabile, P. Dubreuil, and G. Campadelli-Fiume. 2000. Nectin2␣ (PRR2␣ or HveB) and nectin2␦ are lowefficiency mediators for entry of herpes simplex virus mutants carrying the Leu25Pro substitution in glycoprotein D. J. Virol. 74:1267.

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

myeloid lineage, it is not ubiquitously expressed on all tissuebound myeloid cells. In the human, however, CD200R is expressed on the majority of monocyte/myeloid lineage cells in the peripheral blood. In addition to neutrophils and monocytes, CD200R was strongly expressed on basophils and dendritic cells derived from monocytes. Likewise, preliminary immunocytochemical analysis demonstrates a strong expression of CD200R on myeloid cells of normal human skin and lung (data not shown). Mast cells, which are derived from hemopoietic progenitors, play a critical effector role in allergic diseases and IgE-dependent immune responses. Engagement of the high affinity FcR for IgE on mast cells and basophils triggers a series of biochemical events resulting in the secretion of a variety of inflammatory mediators, including histamine, sulfated proteoglycans, proteinases, and cytokines (28). The prominent expression of CD200R on both mouse and human mast cells suggests that this receptor may function as a constitutive regulator of mast cell biological responses. Although we have not yet investigated the expression of CD200R on freshly isolated mast cells, mast cells derived from hemopoietic progenitors clearly express both high levels of specific mRNA for CD200R as well as cell surface protein (data not shown). Previous in vivo studies have implicated the CD200R in the regulation of experimental autoimmune encephalomyelitis (EAE) and collageninduced arthritis (3, 4, 7). The conclusion from these studies was that CD200R played a major role in the regulation of these autoimmune models by modulating macrophage function. Macrophages are known to contribute to the onset and severity of brain inflammation in the EAE model (29). Several recent studies using mast cell-deficient mice, however, have shown that EAE and collagen-induced arthritis are dependent upon functional mast cells (30, 31). It is possible, therefore, that some of the effects of CD200R in these models are manifested through the regulation of mast cell functions. The molecular and biological functions of CD200R expression on mast cells are presently a major focus of ongoing studies. Two of the mouse genes of the CD200 receptor family (mCD200RLa and mCD200RLb) associate with DAP12 and require DAP12 for stable cell surface expression. DAP12 is a small disulfide-bonded homodimer that is structurally similar to Fc⑀RI␥ chain and the TCR␨ chain (32, 33). The transmembrane domain of DAP12 contains a negatively charged aspartic acid residue that allows pairing with a variety of cell surface receptors with positively charged amino acid residues in their transmembrane regions. The cytoplasmic domain of DAP12 contains a consensus immunoreceptor tyrosine-based activation motif, which when phosphorylated recruits protein tyrosine kinases (32–35). Pairing of mCD200RLa and mCD200RLb with DAP12 clearly defines these proteins as potentially activating receptors. mCD200RLa and mCD200RLb do not bind mCD200, despite extensive sequence similarity in the extracellular regions at least for CD200RLa (84 and 39% identity for CD200RLa and CD200RLb with CD200R, respectively). The ligands of CD200RLa and CD200RLb and the functional and biological significance of these receptors are unknown; however, it is possible that these receptors have evolved to interact with viral proteins in a manner similar to that recently described for a DAP12 pairing member of the Ly-49 family and mouse CMV (36, 37). The human homologue of mCD200RLa, hCD200RLa, is structurally very similar to the mouse gene, including the positively charged residue in the transmembrane domain. It seems likely that hCD200RLa is a nonfunctional gene, as no expression could be detected despite many attempts with a variety of adapter molecules. CD200R is a member of a group of proteins expressed on myeloid cells, but we now report expression on many T cells in mouse and human in contrast to earlier data in the rat (3). In the mouse,

3045

3046

32. Lanier, L. L., B. C. Corliss, J. Wu, C. Leong, and J. H. Phillips. 1998. Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391:703. 33. Tomasello, E., L. Olcese, F. Vely, C. Geourgeon, M. Blery, A. Moqrich, D. Gautheret, M. Djabali, M. G. Mattei, and E. Vivier. 1998. Gene structure, expression pattern, and biological activity of mouse killer cell activating receptorassociated protein (KARAP)/DAP-12. J. Biol. Chem. 273:34115. 34. McVicar, D. W., L. S. Taylor, P. Gosselin, J. Willette-Brown, A. I. Mikhael, R. L. Geahlen, M. C. Nakamura, P. Linnemeyer, W. E. Seaman, S. K. Anderson, et al. 1998. DAP12-mediated signal transduction in natural killer cells: a dominant role for the Syk protein-tyrosine kinase. J. Biol. Chem. 273:32934. 35. Lanier, L. L., B. Corliss, J. Wu, and J. H. Phillips. 1998. Association of DAP12 with activating CD94/NKG2C NK cell receptors. Immunity 8:693. 36. Smith, H. R., J. W. Heusel, I. K. Mehta, S. Kim, B. G. Dorner, O. V. Naidenko, K. Iizuka, H. Furukawa, D. L. Beckman, J. T. Pingel, et al. 2002. Recognition of a virus-encoded ligand by a natural killer cell activation receptor. Proc. Natl. Acad. Sci. USA 99:8826. 37. Arase, H., E. S. Mocarski, A. E. Campbell, A. B. Hill, and L. L. Lanier. 2002. Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science 296:1323. 38. Tomasello, E., C. Cant, H. J. Buhring, F. Vely, P. Andre, M. Seiffert, A. Ullrich, and E. Vivier. 2000. Association of signal-regulatory proteins ␤ with KARAP/ DAP-12. Eur. J. Immunol. 30:2147. 39. Billadeau, D. D., and P. J. Leibson. 2002. ITAMs versus ITIMs: striking a balance during cell regulation. J. Clin. Invest. 109:161. 40. Veillette, A., S. Latour, and D. Davidson. 2002. Negative regulation of immunoreceptor signaling. Annu. Rev. Immunol. 20:669. 41. Long, E. O. 1999. Regulation of immune responses through inhibitory receptors. Annu. Rev. Immunol. 17:875. 42. Higgins, D. G., J. D. Thompson, and T. J. Gibson. 1996. Using CLUSTAL for multiple sequence alignments. Methods Enzymol. 266:383.

Downloaded from http://www.jimmunol.org/ by guest on October 12, 2017

20. McCaughan, G. W., M. J. Clark, J. Hurst, F. Grosveld, and A. N. Barclay. 1987. The gene for MRC OX-2 membrane glycoprotein is localized on human chromosome 3. Immunogenetics 25:133. 21. Laminet, A. A., G. Apell, L. Conroy, and W. M. Kavanaugh. 1996. Affinity, specificity, and kinetics of the interaction of the SHC phosphotyrosine binding domain with asparagine-X-X-phosphotyrosine motifs of growth factor receptors. J. Biol. Chem. 271:264. 22. Van der Geer, P., S. Wiley, G. D. Gish, V. K.-M. Lai, R. Stephens, M. F. White, D. Kaplan, and T. Pawson. 1996. Identification of residues that control specific binding of the Shc phosphotyrosine-binding domain to phosphotyrosine sites. Proc. Natl. Acad. Sci. USA 93:963. 23. Wipke, B. T., and P. M. Allen. 2001. Essential role of neutrophils in the initiation and progression of a murine model of rheumatoid arthritis. J. Immunol. 167:1601. 24. Wills-Karp, M. 1999. Immunologic basis of antigen-induced airway hyperresponsiveness. Annu. Rev. Immunol. 17:255. 25. Elias, J. A., L. Cohn, and G. Chupp. Pathophysiology of human asthma. Annu. Rev. Immunol. In press. 26. Holgate, S. T. 1999. The epidemic of allergy and asthma. Nature 402:B2. 27. Lee, S. C., Z. H. Jaffar, K. S. Wan, S. T. Holgate, and K. Roberts. 1999. Regulation of pulmonary T cell responses to inhaled antigens: role of Th1 and Th2 mediated inflammation. J. Immunol. 162:6867. 28. Marone, G., L. M. Lichtenstein, and S. Galli. 2000. Mast cells and basophils. Academic Press, San Diego, CA. 29. Huitinga, I., N. van Rooijen, C. J. de Groot, B. M. Uitdehaag, and C. D. Dijkstra. 1990. Suppression of experimental allergic encephalomyelitis in Lewis rats after elimination of macrophages. J. Exp. Med. 172:1025. 30. Lee, D. M., D. S. Friend, M. F. Gurish, C. Benoist, D. Mathis, and M. B. Brenner. 2002. Mast cells: a cellular link between autoantibodies and inflammatory arthritis. Science 297:1689. 31. Secor, V. H., W. E. Secor, C.-A. Gutekunst, and M. A. Brown. 2000. Mast cells are essential for early onset and severe disease in a murine model of multiple sclerosis. J. Exp. Med. 191:813.

HUMAN AND MOUSE CD200 RECEPTOR