Human mitochondrial GrpE is a symmetric free dimer in solution. Júlio C. Borges1,2, Hannes ...

JBC Papers in Press. Published on July 2, 2003 as Manuscript M305083200 Conformational studies of human GrpE.

Human mitochondrial GrpE is a symmetric free dimer in solution.

Júlio C. Borges1,2, Hannes Fischer3, Aldo F. Craievich3, Lee D. Hansen4, Carlos H.I. Ramos1,2*

1

Centro de Biologia Molecular Estrutural. LNLS; PO Box 6192 Zip code: 13084-971 - Campinas SP,

Brazil. Departamento de Bioquímica, Instituto de Biologia. UNICAMP, Campinas SP, Brazil.

3

Departamento de Física Aplicada, Instituto de Física, USP- São Paulo SP, Brazil.

4

Department of Chemistry and Biochemistry, Brigham Young University, Provo UT, USA

*Corresponding author: Fax: 55-19-3287-7110. E-mail: [email protected]

Running title: Conformational studies of human GrpE.

1 Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

Downloaded from http://www.jbc.org/ by guest on October 13, 2017

2

Conformational studies of human GrpE.

Abstract

The co-chaperone GrpE is essential for the activities of the Hsp70 system which assists protein folding. GrpE is present in several organisms and characterization of homologous GrpEs is important for developing structure-function relationships. Cloning, producing, and conformational studies of the recombinant human mitochondrial GrpE is reported here. Circular dichroism measurements demonstrate that the purified protein is folded. Thermal unfolding of human GrpE measured both by circular dichroism and differential scanning calorimetry differs from that of

sedimentation coefficient agrees with an elongated shape model. Small angle X-ray scattering analysis shows the protein possesses an elongated shape in solution, and demonstrates that its envelope, determined by an ab initio method, is similar to the high resolution envelope of Escherichia coli GrpE bound to DnaK obtained from single crystal X-ray diffraction. However, in these conditions, the Escherichia coli GrpE dimer is asymmetric since the monomer that binds DnaK adopts an open conformation. It is of considerable importance for structural GrpE research to answer the question of whether the GrpE dimer is only asymmetric while bound to DnaK or also as free dimer in solution. The low-resolution structure of human GrpE presented here suggests that GrpE is a symmetric dimer when not bound to DnaK. This information is important for understanding the conformational changes GrpE undergoes on binding to DnaK.

Keywords: GrpE, heat shock protein, small angle X-ray scattering, analytical ultracentrifugation, protein in solution.

2

Downloaded from http://www.jbc.org/ by guest on October 13, 2017

prokaryotic GrpE. Analytical ultracentrifugation data indicate that human GrpE is a dimer and the

Conformational studies of human GrpE.

Introduction

Nascent proteins in the cell sometimes require the assistance of one or more protein complexes named molecular chaperones to fold correctly [1,2]. An important chaperone complex is composed of the molecular chaperones Hsp701, Hsp40 (or DnaK and DnaJ, respectively) and GrpE, which are highly expressed and important for several cell processes [3-7]. The Hsp70 affinity for unfolded proteins is regulated by nucleotide binding to its nucleotide binding domain (NBD) which has a molecular weight of about 45 kDa [5,8]. Hsp70 C-terminus forms the substrate binding domain

about 20 kDa [8,9]. Co-chaperones Hsp40 and GrpE interact both in vivo and in vitro with DnaK [6,10,11] stimulating its ATPase activity [12], and regulating the ability of DnaK to bind and stabilize unfolded proteins [13]. The importance of GrpE in the Hsp70 chaperone machinery is shown by the following: it is essential for bacterial viability at all temperatures [14], GrpE acts as an exchange factor that releases nucleotides bound to DnaK [12], and it is important for DnaK recycling [11]. The first indication that GrpE was a homodimer came from crosslinking studies with glutaraldehyde [15]. Subsequently, analytical ultracentrifugation experiments [16] showed that GrpE has a dimeric structure with an elongated shape that binds DnaK with 2:1 stoichiometry. The crystallographic high resolution structure of residues 34-197 of Escherichia coli GrpE (EcGrpE34-197) complexed with the E. coli DnaK-NBD (EcDnaK3-383) corroborates that GrpE forms a dimer and shows that only one of the subunits, known as proximal monomer, binds to Hsp70 [17]. In this structure, the GrpE dimer is asymmetric since the proximal monomer adopts a more open conformation than the distal monomer. Knowing whether this asymmetric conformation remains while

1

Abbreviations used: Hsp: heat shock protein; NBD: nucleotide binding domain of Hsp70; SBD: substrate binding domain of Hsp70; SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis; CD: circular dichroism; DSC, differential scanning calorimetry; AUC: analytical ultracentrifugation; SAXS: small angle X-ray scattering.

3

Downloaded from http://www.jbc.org/ by guest on October 13, 2017

(SBD) which is capable of binding hydrophobic amino acid residues and has a molecular weight of

Conformational studies of human GrpE.

GrpE is free in solution, is necessary for understanding this protein structure-function relationship in the cell. The GrpE C-terminus domain, EcGrpE141-197, is beta structured and binds to the DnaK-NBD causing the release of ADP from NBD [17]. The function of the GrpE N-terminus remains to be fully understood. The GrpE40-86 domain forms a long coil-coiled alpha helix structure [17] and may function as a thermosensor since it appears to be responsible for the GrpE thermal transition at physiological temperatures [18]. GrpE appears to be the only component of the Hsp70 chaperone machinery that undergoes a thermal transition at a physiologically relevant temperature [19]. The GrpE89-137 domain forms a four-helix bundle [17] and likely acts as the stabilization center for dimerization [18]. GrpE is

with their prokaryote homologues. Thus, it is important to characterize the structure and function of GrpE from diverse organisms to test this hypothesis. The sequence of human mitochondrial GrpE [23] is represented in Figure 1 along with the E. coli GrpE sequence showing that they share about 30% identity. The mitochondrial form of human GrpE is expressed as an immature protein that matures when its mitochondrial signaling peptide is lost. Human GrpE was cloned and expressed in E. coli, and purified by ion exchange chromatography and preparative molecular exchange chromatography. The secondary structure characterized by circular dichroism (CD) showed the protein is folded. Temperature-induced unfolding followed either by CD or by differential scanning calorimetry (DSC) showed that human GrpE unfolding is only partially reversible whereas E. coli GrpE exhibits reversible unfolding up to 60 oC [19]. Analytical ultracentrifugation (AUC) data indicate the protein has the molecular weight of a dimer and the calculated sedimentation coefficient agrees with the value expected for a protein with an elongated shape. The elongated shape was also derived independently from small angle X-ray scattering analysis (SAXS). The hydrodynamic parameters derived from SAXS data agree with those determined by analytical ultracentrifugation. Our envelope models are similar to the envelope of the crystallographic structure of E. coli GrpE bound to the DnaK-nucleotide binding domain determined

4

Downloaded from http://www.jbc.org/ by guest on October 13, 2017

present in eukaryotes [20,21,22] and it is generally assumed that they share high structural similarity

Conformational studies of human GrpE.

by Harrison et al. [17]. The low-resolution structure generated from our SAXS data in solution suggests that GrpE is a symmetric dimer when not bound to DnaK. The implications of our conclusions concerning human GrpE conformational changes in structure-function relationships of this co-chaperone are discussed.

Experimental procedures

The human cDNA IMAGE clone (GenBank accession number BE614754) was used for cloning the mitochondrial GrpE (Mt-GrpE#1, GenBank accession number Q9HAV7). Two primers were used to amplify the cDNA by PCR and to create the restriction enzyme sites Nde I and Xho I for cloning into pET23a vector (Novagen). The 5’-primer (5’ TCTCCCCGGCATATGTGCACAG 3’) containing the Nde I restriction site was designed to anneal downstream to the mitochondrial peptide signal, eliminating this sequence in the recombinant protein. The correct cloning was confirmed by DNA sequencing using an ABI 377 Prism system (Perkin Elmer). These procedures created the pET23aHMGrpE#1 vector which was transformed in E. coli strain BL21(DE3) for protein expression E\DGGLQJP0RO/RILVRSURS\OWKLR 'JDODFWRVLGH,37* DW2'600 = 0.8. The induced cells were grown for 5 hours and harvested by centrifugation for 10 minutes at 2600 xg. The bacterial pellet was resuspended in lysis buffer (50 mmol/L Tris-HCl pH 8.0, 50 mmol/L KCl and 10 mmol/L EDTA-15 mL per liter of medium), disrupted by sonication in an ice bath, and centrifuged as described above. The supernatant was dialyzed against equilibration buffer (25 mmol/L Tris-HCl pH 7.5, 1 mmol/L DTT), and then submitted to ion exchange chromatography on Q-Sepharose resin using an ÄKTA FPLC (Pharmacia Biotech). Human GrpE was eluted in 100 mmol/L NaCl, dialyzed against the second

5

Downloaded from http://www.jbc.org/ by guest on October 13, 2017

Cloning, expression and purification

Conformational studies of human GrpE.

equilibration buffer (25 mmol/L Tris-HCl pH 7.5, 150 mmol/L NaCl, 1 mmol/L DTT) and loaded on a HiLoad Superdex 200pg molecular exclusion column using an ÄKTA FPLC (Pharmacia Biotech). The degree of purification of human GrpE was estimated by SDS-PAGE [24] and its concentration was determined spectrophotometrically using the calculated extinction coefficient for denatured proteins [25,26].

Circular dichroism spectroscopy Circular dichroism (CD) measurements were recorded on a Jasco J-810 spectropolarimeter

resuspended in 10 mmol/L phosphate buffer pH 7.2 and 1 mmol/L PHUFDSWRHWKDQRODWDILQDO concentration of 20 mmol/L. Data were collected at a scanning rate of 50 nm/min with spectral band width of 1 nm using a 1 mm pathlength cell at increasing temperatures (see Figure 3 caption for details). CDNN Deconvolution software (Version 2 – http://Bioinformatik.biochemtech.unihalle.dee/cdnn) was employed for secondary structure prediction. All buffers used were of chemical grade and were filtered before use to avoid scattering from small particles.

Differential scanning calorimetry The measurements of human GrpE thermal denaturation were done both in a N-DSC III Differential Scanning Calorimeter (Calorimetry Sciences Corporation) and in a VP-DSC Differential Scanning Calorimeter (MicroCal), which gave similar results. The measurements were performed with protein concentrations of 7, 45 and 130 µmol/L and in two sets of buffers; 25 mmol/L Hepes pH 7.6, 50 mmol/L KCl and 5 mmol/L MgCl2; and 25 mmol/L Tris-HCl 25 mmol/L, NaCl from 150 to 500 mmol/L and b-mercaptoethanol 1 mmol/L. The scan rate was varied from 0.5 to 1.5 oC/min and the temperature measurement range was from 10 to 100 oC. The reversibility of unfolding was tested by

6

Downloaded from http://www.jbc.org/ by guest on October 13, 2017

with temperature controlled by Peltier Type Control System PFD 425S. Human GrpE was

Conformational studies of human GrpE.

performing several consecutive up and down scans and by scan rate variation. Baselines were run several times in all the conditions mentioned above.

Analytical ultracentrifugation Sedimentation velocity and sedimentation equilibrium experiments were performed with a Beckman Optima XL-A analytical ultracentrifuge. The protein was tested in concentrations of 50, 100, and 200 µg/ml in 25 mmol/L Tris-HCl buffer at pH 7.5, with 150 mmol/L NaCl and 0.5 mmol/L DTT, with no apparent aggregation. The sedimentation velocity experiments were carried out at 20 oC,

equilibrium experiments were made at 20 oC at speeds of 7,000, 9,000, and 11,000 rpm using the AN-60Ti rotor. Scan data acquisition was done at 230 nm. The analysis involved fitting a model of absorbance versus cell radius data by nonlinear regression. All the fits were done with the ORIGIN software package (MicroCal Software) supplied with the instrument. The van Holde-Weischet [27] (sediment coefficient plot), Second Moment [28] and the Sedimentation Time Derivative (g(s*) integral distribution) [29] methods were used to analyze the sedimentation velocity experiments. The methods used for analyzing both velocity and equilibrium experiments allow the calculation of the apparent sedimentation coefficient s, the diffusion coefficient D, and the molecular weight M. The ratio of the sedimentation to diffusion coefficient gives the molecular weight:

M =

sRT D(1 - Vbarr )

equation 1

R is the gas constant and T is the absolute temperature. The software Sednterp (www.jphilo.mailway.com/download.htm) was used to estimate protein partial specific volume (Vbar= P/J EXIIHUGHQVLW\

JP/ DQGEXIIHUYLVFRVLW\

SRLVH 7KH6HOI

Association method was used to analyze the sedimentation equilibrium experiments using several

7

Downloaded from http://www.jbc.org/ by guest on October 13, 2017

40,000 rpm (AN-60Ti rotor), and the scan data acquisition was taken at 230 nm. The sedimentation

Conformational studies of human GrpE.

models of association for human GrpE to fit the data. The distribution of the protein along the cell, obtained in the equilibrium sedimentation experiments, was fitted with the following equation [30]:

C = C 0 exp[

(

)

M (1 - Vbar r )w 2 r 2 - r0 ] 2 RT

equation 2

where C is the protein concentration at radial position r, C0 is the protein concentration at radial position r0, and w is the centrifugal angular velocity.

Small angle X-ray scattering (SAXS)

synchrotron radiation facility, Campinas, Brazil [31]. Measurements were make with a monochromatic X-ray beam with a wavelength l=1.488 Å for a sample-detector distance of 840 mm covering the momentum transfer range 0.01 < q < 0.44 Å-1 (q=4psinq/l, where 2q is the scattering angle). The scattering intensity was recorded using a 1D position sensitive X-ray detector. The scattering curves produced by the protein solutions of either 5.0 or 19.4 mg/mL and of the solvent (Tris-HCl 25 mM pH 7.5 and DTT 1 mmol/L) were collected in many short (90 second) frames in order to monitor radiation damage and beam stability. The data were normalized to account for the natural decay in intensity of the synchrotron incident beam and corrected for inhomogeneous detector response. The scattering intensity produced by the buffer was subtracted and the difference curves were scaled to equivalent protein concentration. To determine the molecular weight of human GrpE, a 5 mg/mL bovine serum albumin (66 kDa) solution was used as a standard. The molecular weight of human GrpE was inferred from the ratio of the extrapolated I(0) value of human GrpE to that of bovine serum albumin. Since there was no negative region in the pair distribution function, we can safely conclude that all the solutions

8

Downloaded from http://www.jbc.org/ by guest on October 13, 2017

Small-angle X-ray scattering experiments were performed at the SAS beamline of the LNLS

Conformational studies of human GrpE.

studied were in the “dilute” state, i. e. no interferences of scattering amplitudes were produced by the interaction of different isolated scattering objects.

Models and computer programs The distance distribution function p(r) and the radius of gyration Rg of the human GrpE protein were evaluated from the corrected and normalized SAXS curves by the indirect Fourier transform program GNOM [32,33]. A constant was subtracted from the experimental data to ensure that the intensity at higher angles decayed as q-4 following Porod´s law for a two-electron density model [34].

to q4I(q) versus q4 plots by the shape determination program DAMMIN [35] that will be described later. This procedure reduces the contribution from scattering due to the short range fluctuations of the internal protein structure and yields an approximation of the "shape scattering curve” (i.e. the scattering intensity produced by the excluded volume of a particle with a spatially constant density). The low-resolution shape of GrpE was obtained from the experimental SAXS data with an ab initio method implemented in DAMMIN [34]. A sphere of diameter Dmax was filled by a regular grid of points corresponding to a dense hexagonal packing of small spheres (dummy atoms) of radius r0